Advertisement

Platelet aggregation abnormalities in patients with fetal losses: the GP6 gene polymorphism

      Objective

      To evaluate the GP6 gene polymorphism in patients with sticky platelet syndrome (SPS) and fetal loss.

      Design

      Genetic association study.

      Setting

      Perinatal center.

      Patient(s)

      Twenty-seven patients with SPS, manifested as fetal loss, and 42 control subjects without SPS and no history of fetal loss and thrombosis.

      Intervention(s)

      SPS was diagnosed by platelet aggregometry (PACKS-4 aggregometer; Helena Laboratories). Seven single-nucleotide polymorphisms (SNPs) of the GP6 gene were evaluated.

      Main Outcome Measure(s)

      Occurrence of SNPs of the GP6 gene in SPS patients versus control subjects.

      Result(s)

      We found a higher occurrence of three SNPs of the GP6 gene in SPS patients versus control subjects (rs1671153: 0.204 vs. 0.048, odds ratio [OR] 5.116, 95% confidence interval [CI] 1.536–17.03; rs1654419: 0.204 vs. 0.071, OR 3.326, 95% CI 1.149–9.619; rs1613662: 0.204 vs. 0.071, OR 3.326, 95% CI 1.149–9.619). The haplotype analysis showed a significantly higher occurrence of two haplotypes (CTGAG in haplotype 5: 0.185 vs. 0.059, OR 3.568, 95% CI 1.142–11.14; and CGATAG in haplotype 6: 0.204 vs. 0.048, OR 4.961, 95% CI 1.488–16.53).

      Conclusion(s)

      Our results, especially the higher occurrence of haplotypes CTGAG and CGATAG in SPS patients, support the idea that GP6 gene polymorphism may be associated with platelet hyperaggregability, a possible cause of fetal loss.

      Key Words

      Discuss: You can discuss this article with its authors and with other ASRM members at http://fertstertforum.com/sokolj-platelet-aggregation-abnormalities-fetal-losses-gp6-gene-polymorphism/
      Sticky platelet syndrome (SPS) was described by Holliday at the 9th Conference on Stroke and Cerebral Circulation in Arizona in 1983 (
      • Bick R.L.
      Sticky platelet syndrome: a common cause of unexplained arterial and venous thrombosis.
      ). The results of recent studies suggest SPS to be a common cause of arterial and venous thrombosis. According to Mammen and Bick, SPS is the second most common hereditary thrombophilia after resistance to activated protein C (APC-R) and the most common thrombophilia associated with arterial thrombosis, with an incidence of ∼21% (
      • Bick R.L.
      Sticky platelet syndrome: a common cause of unexplained arterial and venous thrombosis.
      ,
      • Mammen E.F.
      Ten years' experience with the “sticky platelet syndrome.”.
      ,
      • Kubisz P.
      • Ivankova J.
      • Holly P.
      • Stasko J.
      • Musial J.
      The glycoprotein IIIaPL(A1/A2) polymorphism—a defect responsible for sticky platelet syndrome?.
      ). However, SPS is the second most common thrombophilia that causes recurrent spontaneous abortions or fetal loss syndrome (
      • Bick R.L.
      • Hoppensteadt D.
      Recurrent miscarriage syndrome due to blood coagulation protein/platelet defects: a review and update.
      ,
      • Bick R.L.
      • Laughlin H.R.
      • Cohen B.M.
      • Staub A.J.
      • Madden J.
      • Toofanian A.
      Fetal wastage syndrome due to blood protein/platelet defects: results of prevalence studies and treatment outcome with low-dose heparin and low-dose aspirin.
      ,
      • Bick R.L.
      Recurrent miscarriage syndrome due to blood coagulation protein/platelet defects: prevalence, treatment and outcome results.
      ).
      SPS is diagnosed by aggregometry (platelet aggregation measurement performed by aggregometer) after platelet activation by inducers—adenosine diphosphate (ADP) and/or epinephrine (EPI). According to the results of aggregometry, SPS is classified as type I (hyperaggregation after both ADP and EPI), type II (hyperaggregation after EPI alone), and type III (hyperaggregation after ADP alone). SPS type II seems to be the most common (
      • Bick R.L.
      Sticky platelet syndrome: a common cause of unexplained arterial and venous thrombosis.
      ,
      • Mammen E.F.
      Ten years' experience with the “sticky platelet syndrome.”.
      ).
      SPS is probably a hereditary autosomal-dominant thrombophilia, although the exact genetic cause has yet to be identified. It has been suggested that the defects of the platelet membrane glycoproteins or intracellular signal pathways involved in platelet activation and aggregation are responsible for the disorder (
      • Kubisz P.
      • Ivankova J.
      • Holly P.
      • Stasko J.
      • Musial J.
      The glycoprotein IIIaPL(A1/A2) polymorphism—a defect responsible for sticky platelet syndrome?.
      ,
      • Kubisz P.
      • Musial J.
      • Stasko J.
      • Ivankova J.
      • Dobrotova M.
      • Plamenova I.
      • et al.
      Sticky platelet syndrome (SPS) and platelet glycoprotein polymorphisms.
      ).
      Glycoprotein VI (GPVI), a member of the immunoglobulin superfamily, is a 58-kDa platelet transmembrane glycoprotein consisting of 319 amino acids, located in the platelet membrane in noncovalent complex with FcRγ subunit (
      • Jandrot-Perrus M.
      • Busfield S.
      • Lagrue A.H.
      • Xiong X.
      • Debili N.
      • Chickering T.
      • et al.
      Cloning, characterization, and functional studies of human and mouse glycoprotein VI: a platelet-specific collagen receptor from the immunoglobulin superfamily.
      ). Vessel wall damage exposes the subendothelial component collagen to platelets in the blood flow. Interaction of platelets with collagen via the GPVI receptor results in platelet activation and adhesion, processes that are essential for thrombus formation. GPVI was shown by several in vitro and in vivo studies to be essential for activation of integrin for stable adhesion and subsequent signal transduction (via activation of phosphatidylinositol-3-kinase and phospholipase Cγ2) that leads to granule release, activation of GPIIb/IIIa via inside-out signaling, and platelet aggregation (
      • Clemetson K.J.
      • Clemetson J.M.
      Platelet collagen receptors.
      ).
      Considering the critical role of GPVI in collagen-initiated signal transduction and platelet procoagulant activity, the observed variation in GPVI content may influence risk for thromboembolic disorders (
      • Furihata K.
      • Kunicki T.J.
      Characterization of human glycoprotein VI gene 5′ regulatory and promoter regions.
      ). GPVI is a product of the GP6 gene, which is localized on chromosome 19 (19q13.4) (
      • Clemetson J.M.
      • Polgar J.
      • Magnenat E.
      • Wells T.N.
      • Clemetson K.J.
      The platelet collagen receptor glycoprotein VI is a member of the immunoglobulin superfamily closely related to FcalphaR and the natural killer receptors.
      ). Since the identification and analysis of the GP6 gene in the 1990s, its numerous single-nucleotide polymorphisms (SNPs) have been identified (). However, the clinical importance for hemostasis, if any, as well as of the majority of polymorphisms, is not yet clear.
      The aim of the present study was to evaluate the gene variability of the GP6 gene in a group of patients with SPS type I or II manifested as fetal loss and a control group to analyze the association of GPVI with SPS and thus to identify the genetic changes of the GP6 gene with a possible role in platelet hyperaggregability.

      Materials and methods

       Study Population and Inclusion/Exclusion Criteria

      The study was approved by the Ethical Committee, Jessenius Faculty of Medicine, Comenius University (no. EK603/2010). Informed consent was obtained from each participant.
      All patients were initially examined and tested at the Department of Hematology and Transfusiology. They were referred to undergo thrombophilia screening as a part of spontaneous abortion differential diagnosis. Patients with verified spontaneous abortion and SPS were asked to participate in genotype testing. Thus, all patients fulfilled the following inclusion criteria: at least one spontaneous abortion; and confirmation of SPS according to the criteria of Mammen (
      • Mammen E.F.
      Ten years' experience with the “sticky platelet syndrome.”.
      ,
      • Mammen E.F.
      • Barnhart M.J.
      • Selik N.R.
      • Gilroy J.
      • Klepach G.L.
      “Sticky platelet syndrome”: a congenital platelet abnormality predisposing to thrombosis?.
      ). A total number of patients with one to four spontaneous abortions were: 10 (37.04%), 12 (44.44%), 4 (14.81%), and 1 (3.70%), respectively. The average gestational weeks and standard deviation were: 15.15 ± 8.51, 11.00 ± 4.97, 10.75 ± 2.63, and 8, respectively (Table 1). Occurrence of other thromboembolic events (e.g., venous thromboembolism, myocardial infarction) was not considered as a reason for exclusion of patients. A total of 27 patients were diagnosed as SPS type I or II in the cohort. Furthermore, 42 randomly chosen healthy blood donors from the same region of Zilina, the northwestern part of Slovakia, were involved as control subjects. All control subjects fulfilled the following criteria: negative personal history for ischemic stroke or other thromboembolic events; and negative laboratory testing for SPS.
      Table 1Gestational week of fetal losses in followed patients.
      Patient no.1st fetal loss2nd fetal loss3rd fetal loss4th fetal loss
      112
      21212
      3129
      42818
      587
      68888
      7289
      87
      9108
      1012
      11778
      12209
      13126
      141217
      15479
      16712
      1720
      1829
      1915
      2013
      2127
      2255
      2332
      242520
      25121213
      267813
      2725

       Diagnostics of SPS

      The antecubital venous blood was collected into tubes of 3.2% buffered sodium citrate (anticoagulant-blood ratio 1:9) to assess the platelet aggregation. The samples were processed and analyzed within 2 hours after sampling. Platelet aggregability was tested with the use of platelet aggregometry (PACKS-4 aggregometer, Helena Laboratories) according to Mammen (
      • Mammen E.F.
      Ten years' experience with the “sticky platelet syndrome.”.
      ,
      • Mammen E.F.
      Sticky platelet syndrome.
      ): Each sample was tested with three low concentrations of ADP (2.34 μmol/L, 1.17 μmol/L, 0.58 μmol/L) and EPI (11.0 μmol/L, 1.1 μmol/L, 0.55 μmol/L). Aggregation was assessed photometrically by platelet aggregometer with the use of platelet-rich plasma. SPS was classified as type I (hyperaggregation after both ADP and EPI), type II (hyperaggregation after EPI alone), or type III (hyperaggregation after ADP alone). We repeated measurements for each sample and concentration five times with an intra-assay coefficient of variation in the range of 3.6%–4.5%. The testing was performed on patients without antiplatelet therapy (discontinuation of acetylsalicylic acid or ADP inhibitor treatment for ≥7 days before testing, omitting the use of other drugs with possible effect on platelet activity, e.g., nonsteroidal antiinflammatory drugs) and without an occurence of acute thromboembolic events (≥3–5 months).

       GP6 Gene Analysis

      For the selection of tagged SNPs, data from the International Hapmap Project (

      SNP of GP6 gene. Available at: http://hapmap.ncbi.nlm.nih.gov/. Accessed February 27, 2012.

      ) and an adopted algorithm implemented in Haploview 4.2 were used (
      • Barret J.C.
      • Fry B.
      • Maller J.
      • Daly M.J.
      Haploview: analysis and visualization of LD and haplotype maps.
      ). Parameters for Haploview 4.2 were: Hapmap data release 27 phase II + III, on NCBI B36 assembly, dbSNP b126, chromosome 19, region 60,216–60,242 kb, analysis panel CEU, r2 0.8, MAF >0.1, pairwise tagging. In total, 20 SNPs were identified with the algorithm, and six SNPs (rs1654410, rs1671153, rs1654419, rs11669150, rs12610286, rs1654431) were chosen for analysis. The basic characteristics of the analyzed SNPs including nucleotide sequence are presented in Table 2 and their further details are described elsewhere (

      Human glycoprotein VI single nucleotide polymorphisms. Available at: http://www.ensembl.org/Homo_sapiens/Gene/Summary?g=ENSG00000088053;r=19:55525073–55549632/. Accessed February 27, 2012.

      ).
      Table 2Characteristics of the examined GP6 gene SNPs.
      SNPPosition on chromosome 19Major/minor alleleSNP sequence5′-forward primer-3′5′-reverse primer-3′RE
      rs165441055524813T/CTCTGTC/TTTCTGAGTACCTGAGAGTAGGCATGTGGCTCCAAATGTAAGAATGGGTCAAMbo II
      rs167115355527189T/GCATGGT/GGAGGCCTTTGGACTGGCGGTGATCGGCCCATGCTTTTCTTAHph I
      rs165441955535881G/ACGTCCG/ACCTTTGGCTCTTTCCAGCATGTTTCTTGTGTGAGGCGTGTTATCCCse I
      rs1166915055535972T/CTGAGAT/CGTTTGTGCAGGCCGTAGTCTGGTTGCTGCTTTGAGAACCACTGAlw26 I
      rs161366255536595A/GTACCGA/GGGAAGAGGGGTCCGTGTACCTCAAGGACCCACAGCGACAGAMsp I
      rs1261028655541399A/GTTAACA/GTATTTATTAGGGTGGCGTGGCGTGAGTGCATCCACAAAAGCCTAGATai I
      rs1261028655541399A/GTTAACA/GTATTTGGATGTAAAATTTAATTATTCCCAAAAACGACCTACTCTTCAAATTTTCHRM
      High-resolution melt (HRM) primers used for high-resolution melt analysis of rs12610286 heterozygotes in the check on process.
      rs165443155549758A/GTAGCCA/GGCTCCAGAATGCTCTCCTCCCTTCCCAGGGAGTTTATGGGAGCACAlu I
      Note: RE = restriction endonuclease; SNP = single-nucleotide polymorphism.
      a High-resolution melt (HRM) primers used for high-resolution melt analysis of rs12610286 heterozygotes in the check on process.
      The antecubital venous blood was collected into tubes of 3.2% EDTA, which was used for DNA analysis. Samples were processed within 2 hours of collection and stored, if necessary, at −20°C. DNA was extracted from peripheral blood leukocytes. Isolation of genomic DNA from whole blood was performed with the Simax Genomic DNA Extraction kit (SBS Genetech) according to the manufacturer's instructions. The GP6 gene polymorphisms were identified with the use of restriction fragment length polymorphism and high-resolution melt analysis (in the check on process of one of the tagged SNPs), with an in-house design of individual polymerase chain reaction. Primer3 software was used for the selection of primer sequences (

      Primer3 software. Available at: http://frodo.wi.mit.edu/primer3/input.htm/. Accessed February 27, 2012.

      ). Primers, as well as restriction endonucleases, are listed in Table 2.

       Statistics

      Both single marker and haplotype association analyses were performed with Helixtree software (Golden Helix) (

      HelixTree software. Available at: http://www.goldenhelix.com/. Accessed February 27, 2012.

      ). Fisher exact test was used to estimate the significance of deviation from Hardy-Weinberg equilibrium (HWE) and to execute basic allelic and genotypic association. The level of significance was P<.05. Haplotypes (constructed from six tagged SNPs) were imputed using expectation-maximization (EM) algorithm, and the threshold for haplotype frequency estimation was 0.01. Chi-square test was used for evaluation of haplotype associations.

      Results

      We examined 27 SPS patients with an average age of 32.07 ± 5.8 years and 42 healthy control subjects with an average age of 36.3 ± 12.4 years. We found seven patients to have SPS type I (26.0%), 20 patients SPS type II (74.0%), and no patient SPS type III according to the Mammen criteria (
      • Mammen E.F.
      Ten years' experience with the “sticky platelet syndrome.”.
      ,
      • Mammen E.F.
      • Barnhart M.J.
      • Selik N.R.
      • Gilroy J.
      • Klepach G.L.
      “Sticky platelet syndrome”: a congenital platelet abnormality predisposing to thrombosis?.
      ).
      We found a higher occurrence of three SNPs of the GP6 gene in SPS patients (rs1671153: 0.204 vs. 0.048: odds ratio [OR] 5.116, 95% confidence interval [CI] 1.536–17.03; rs1654419: 0.204 vs. 0.071: OR 3.326, 95% CI 1.149–9.619; rs1613662: 0.204 vs. 0.071: OR 3.326, 95% CI 1.149–9.619). Fisher exact test and the exact Armitage test of case-control differences gave significant results for these three SNPs (Table 3).
      Table 3Frequency of alleles of the GP6 SNPs in SPS patients and control subjects.
      SNPMinor alleleFrequency (SPS)Frequency (control)Fisher HWE P value (SPS)Fisher HWE P value (control)Fisher exact P value (allelic)OR (minor allele)95% CI
      rs1654410C0.5000.4641.000.756.7291.1540.581–2.287
      rs1671153G0.2040.048.2701.000.0095.1161.536–17.03
      rs1654419A0.2040.071.2701.000.0323.3261.149–9.619
      rs11669150C0.2410.286.283.708.6940.7930.362–1.734
      rs1613662G0.2040.071.2701.000.0323.3261.149–9.619
      rs12610286G0.1850.3101.000.718.1160.5070.221–1.160
      rs1654431A0.4260.5241.0001.000.2970.6740.338–1.342
      Note: CI = confidence interval; HWE = Hardy-Weinberg equilibrium; OR = odds ratio; SNP = single-nucleotide polymorphism; SPS = sticky platelet syndrome.
      Haplotype analysis was performed on six tagged SNPs (Haploview performance) and five SNPs (chosen from all seven genotypes after linkage disequilibrium [LD] quality control), respectively. It showed a significantly higher occurrence of two haplotypes (CTGAG in haplotype 5: 0.185 vs. 0.059, OR 3.568, CI 1.142–11.14; and CGATAG in haplotype 6: 0.204 vs. 0.048, OR 4.961, 95% CI 1.488–16.53). The statistically significant differences between patients and control subjects were detected by both haplotype construction methods (Table 4).
      Table 4Frequency in haplotypes 5 and 6 of the most frequent GP6 gene SNPs in SPS patients and control subjects.
      Frequency (SPS)Frequency (control)χ2χ2 P valueOdds ratio95% CI
      Haplotype 5
       CCAAG0.2100.2160.013.9080.9520.412–2.198
       TTAAA0.1940.1610.212.6451.2330.505–3.005
       TTAGA0.1280.1931.054.3050.6050.230–1.589
       TTAAG0.1570.1550.000.9991.0010.390–2.564
       CTGAG0.1850.0595.264.0223.5681.142–11.14
       CTAGA0.0540.0870.545.4600.5930.146–2.405
       CCAAA0.0300.0701.031.3100.4100.069–2.412
       CTAAG0.0190.0160.009.9241.1350.083–15.37
       TTGAA0.0190.0120.097.7561.5520.094–25.43
       CTAGG0.0010.0160.701.4030.0780.000–173.3
      Haplotype 6
       CTGCAG0.2120.2170.027.8700.9330.404–2.150
       TTGTAA0.2150.1770.210.6471.2220.517–2.885
       TTGTGA0.1280.1790.773.3790.6470.243–1.716
       TTGTAG0.1560.1440.015.9021.0620.407–2.763
       CGATAG0.2040.0487.895.0054.9611.488–16.53
       CTGTGA0.0540.0980.939.3330.5110.128–2.028
       CTGCAA0.0290.0681.109.2920.3890.063–2.387
      Note: SNP = single-nucleotide polymorphism; SPS = sticky platelet syndrome; haplotype 6 (rs1654410, rs1671153, rs1654419, rs11669150, rs12610286, rs1654431); haplotype 5 (rs1654410, rs11669150, rs1613662, rs12610286, rs1654431).
      However, the next analysis of SPS patients with two or more pregnancy losses (n = 17) showed a significantly higher frequency in only one SNP (rs1671153: 0.176 vs. 0.048: OR 4.286, 95% CI 1.126–16.308). Occurrence of the next two SNPs was not significant, although it was higher in SPS patients versus control subjects (rs1654419: 0.176 vs. 0.071, OR 2.786, 95% CI 0.830–9.353; and rs1613662: 0.176 vs. 0.071, OR 2.786, 95% CI 0.830–9.353). Haplotype analysis showed a significantly higher occurrence of the same two haplotypes in these patients (CTGAG in haplotype 5: 0.175 vs. 0.058, OR 3.377, 95% CI 0.947–12.034; and CGATAG in haplotype 6: 0.176 vs. 0.048, OR 4.261, 95% CI 1.119–16.21).

      Discussion

      Platelets essentially contribute to the maintenance of vascular integrity and control of hemorrhage after injury. They can be activated by a variety of physiologic and pharmacologic agents. The effects of these activators are exerted through interactions with specific receptors on the platelet plasma membrane. Pregnancy itself is notably a hypercoagulable state, owing at least in part to the physiologic changes in the coagulation and fibrinolytic systems; this has the potential for interaction with an acquired or heritable thrombophilia to cause adverse experiences (
      • Greer I.A.
      Thrombophilia: implication for pregnancy outcome.
      ). There is growing evidence implicating congenital and acquired thrombophilia in the pathophysiologic processes underlying miscarriage. Ruiz-Arguelles et al. showed in a prospective comprehensive study that SPS is the second most common thrombophilia in Mexico (
      • Ruiz-Argüelles G.J.
      • López-Martínez B.
      • Valdés-Tapia P.
      • Gómez-Rangel J.D.
      • Reyes-Núñez V.
      • Garcés-Eisele J.
      Primary thrombophilia in Mexico. V. A comprehensive prospective study indicates that most cases are multifactorial.
      ).
      The GPVI is a crucial platelet membrane glycoprotein for adequate platelet activation, adhesion, and aggregation (
      • Varga-Szabo D.
      • Pleines I.
      • Nieswandt B.
      Cell adhesion mechanisms in platelets.
      ). In the past few years, the question of the impact of genetic changes within the GP6 gene on platelet function has emerged with the identification of numerous polymorphisms of the GP6 gene. The importance of gene variability of the GP6 gene for platelet aggregation was stressed by a recent genome-wide meta-analysis by Johnson et al. (
      • Johnson A.D.
      • Yanek L.R.
      • Chen M.H.
      • Faraday N.
      • Larson M.G.
      • Tofler G.
      • et al.
      Genome-wide meta-analysis identifies seven loci associated with platelet aggregation in response to agonists.
      ). The analysis focused on the evaluation of the genetic influence on platelet functions and identified seven loci associated with platelet aggregation to physiologic agonists (ADP, collagen, and EPI). One of the loci, associated with increased aggregation to collagen, was within the region of the GP6 gene (
      • Johnson A.D.
      • Yanek L.R.
      • Chen M.H.
      • Faraday N.
      • Larson M.G.
      • Tofler G.
      • et al.
      Genome-wide meta-analysis identifies seven loci associated with platelet aggregation in response to agonists.
      ). Though a large number of SNPs have been identified in the GP6 gene to date, with few exceptions their exact relation to platelet function remains unknown (

      Human glycoprotein VI single nucleotide polymorphisms. Available at: http://www.ensembl.org/Homo_sapiens/Gene/Summary?g=ENSG00000088053;r=19:55525073–55549632/. Accessed February 27, 2012.

      ). According to our knowledge, this is true for the polymorphisms examined in the present study. However, their influence on platelet function under normal or pathologic conditions, including platelet functional disorders, has not been evaluated and published so far.
      In the present work, we focused on variability of the GP6 gene in patients with platelet aggregation abnormalities. We found a higher occurrence of three SNPs of the GP6 gene in SPS patients with fetal loss (rs1671153, rs1654419, rs1613662). When we analyzed haplotypes 5 and 6, we found a significantly higher occurrence of CTGAG in haplotype 5 and of CGATAG in haplotype 6.
      The next analysis of SPS patients with two or more pregnancy losses showed a significantly higher frequency of one SNP (rs1671153). Occurrence of the next two SNPs was not significant (rs1654419, rs1613662), though higher in SPS patients versus control subjects. The loss of significance may be caused by lower number of SPS patients with two or more pregnancy losses in our cohort (n = 17). However, the haplotype analysis still showed a significantly higher occurrence of the same two haplotypes in these patients (CTGAG in haplotype 5, CGATAG in haplotype 6).
      The combined influence of gene polymorphisms on platelet function is supported by the observations in several studies that have shown only limited impact of the sole polymorphisms of platelet glycoproteins on platelet function, although overall genetic influence seems to be, as suggested by the testing of siblings and twins, rather high (estimated to be ∼50%) (
      • O'Donnell C.J.
      • Larson M.G.
      • Feng D.
      • Sutherland P.A.
      • Lindpaintner K.
      • Myers R.H.
      • et al.
      Genetic and environmental contributions to platelet aggregation: the Framingham Heart Study.
      ,
      • Hetherington S.L.
      • Singh R.K.
      • Lodwick D.
      • Thompson J.R.
      • Goodall A.H.
      • Samani N.J.
      Dimorphism in the P2Y1 ADP receptor gene is associated with increased platelet activation response to ADP.
      ,
      • Jones C.I.
      • Bray S.
      • Garner S.F.
      • Stephens J.
      • de Bono B.
      • Angenent W.G.
      • et al.
      A functional genomics approach reveals novel quantitative trait loci associated with platelet signaling pathways.
      ).
      Patients with SPS have significantly increased other “platelet activation membrane markers.” The expressions of CD62P, CD63, and CD51 may serve as predictors of thrombophilia in SPS patients. Further studies are required to confirm these results (
      • Stasko J.
      • Bartosova L.
      • Mytnik M.
      • Kubisz P.
      Are the platelets activated in sticky platelet syndrome?.
      ).
      Our results suggest that global variability of the GP6 gene may be associated with platelet hyperaggregability in patients with SPS and fetal loss, as well. These results have to be confirmed by further research.

      References

        • Bick R.L.
        Sticky platelet syndrome: a common cause of unexplained arterial and venous thrombosis.
        Clin Appl Thromb Hemost. 1998; 4: 77-81
        • Mammen E.F.
        Ten years' experience with the “sticky platelet syndrome.”.
        Clin Appl Thromb Hemost. 1995; 1: 66-72
        • Kubisz P.
        • Ivankova J.
        • Holly P.
        • Stasko J.
        • Musial J.
        The glycoprotein IIIaPL(A1/A2) polymorphism—a defect responsible for sticky platelet syndrome?.
        Clin Appl Thromb Hemost. 2006; 12: 117-119
        • Bick R.L.
        • Hoppensteadt D.
        Recurrent miscarriage syndrome due to blood coagulation protein/platelet defects: a review and update.
        Clin Appl Thromb Hemost. 2005; 11: 1-13
        • Bick R.L.
        • Laughlin H.R.
        • Cohen B.M.
        • Staub A.J.
        • Madden J.
        • Toofanian A.
        Fetal wastage syndrome due to blood protein/platelet defects: results of prevalence studies and treatment outcome with low-dose heparin and low-dose aspirin.
        Clin Appl Thromb Hemost. 1995; 1: 286
        • Bick R.L.
        Recurrent miscarriage syndrome due to blood coagulation protein/platelet defects: prevalence, treatment and outcome results.
        Clin Appl Thromb Hemost. 2000; 6: 115-125
        • Kubisz P.
        • Musial J.
        • Stasko J.
        • Ivankova J.
        • Dobrotova M.
        • Plamenova I.
        • et al.
        Sticky platelet syndrome (SPS) and platelet glycoprotein polymorphisms.
        J Thromb Haemost. 2007; 5: P-T-451
        • Jandrot-Perrus M.
        • Busfield S.
        • Lagrue A.H.
        • Xiong X.
        • Debili N.
        • Chickering T.
        • et al.
        Cloning, characterization, and functional studies of human and mouse glycoprotein VI: a platelet-specific collagen receptor from the immunoglobulin superfamily.
        Blood. 2000; 96: 1798-1807
        • Clemetson K.J.
        • Clemetson J.M.
        Platelet collagen receptors.
        Thromb Haemost. 2001; 86: 189-197
        • Furihata K.
        • Kunicki T.J.
        Characterization of human glycoprotein VI gene 5′ regulatory and promoter regions.
        Arterioscler Thromb Vasc Biol. 2002; 22: 1733-1739
        • Clemetson J.M.
        • Polgar J.
        • Magnenat E.
        • Wells T.N.
        • Clemetson K.J.
        The platelet collagen receptor glycoprotein VI is a member of the immunoglobulin superfamily closely related to FcalphaR and the natural killer receptors.
        Biol Chem. 1999; 274: 29019-29024
      1. Human glycoprotein VI. Available at: http://www.genecards.org/cgi-bin/carddisp.pl?gene=GP6&bioalma_dis_art=all&snp=457&rf=/home/genecards/current/website/carddisp.pl#novoseek_dis/. Accessed February 27, 2012.

        • Mammen E.F.
        • Barnhart M.J.
        • Selik N.R.
        • Gilroy J.
        • Klepach G.L.
        “Sticky platelet syndrome”: a congenital platelet abnormality predisposing to thrombosis?.
        Folia Haematol Int Mag Klin Morphol Blutforsch. 1988; 115: 361-365
        • Mammen E.F.
        Sticky platelet syndrome.
        Semin Thromb Hemost. 1999; 25: 361-365
      2. SNP of GP6 gene. Available at: http://hapmap.ncbi.nlm.nih.gov/. Accessed February 27, 2012.

        • Barret J.C.
        • Fry B.
        • Maller J.
        • Daly M.J.
        Haploview: analysis and visualization of LD and haplotype maps.
        Bioinformatics. 2005; 21: 263-265
      3. Human glycoprotein VI single nucleotide polymorphisms. Available at: http://www.ensembl.org/Homo_sapiens/Gene/Summary?g=ENSG00000088053;r=19:55525073–55549632/. Accessed February 27, 2012.

      4. Primer3 software. Available at: http://frodo.wi.mit.edu/primer3/input.htm/. Accessed February 27, 2012.

      5. HelixTree software. Available at: http://www.goldenhelix.com/. Accessed February 27, 2012.

        • Greer I.A.
        Thrombophilia: implication for pregnancy outcome.
        Thromb Res. 2003; 109: 73-81
        • Ruiz-Argüelles G.J.
        • López-Martínez B.
        • Valdés-Tapia P.
        • Gómez-Rangel J.D.
        • Reyes-Núñez V.
        • Garcés-Eisele J.
        Primary thrombophilia in Mexico. V. A comprehensive prospective study indicates that most cases are multifactorial.
        Am J Hematol. 2005; 78: 21-26
        • Varga-Szabo D.
        • Pleines I.
        • Nieswandt B.
        Cell adhesion mechanisms in platelets.
        Arterioscler Thromb Vasc Biol. 2008; 28: 403-412
        • Johnson A.D.
        • Yanek L.R.
        • Chen M.H.
        • Faraday N.
        • Larson M.G.
        • Tofler G.
        • et al.
        Genome-wide meta-analysis identifies seven loci associated with platelet aggregation in response to agonists.
        Nat Genet. 2010; 42: 608-613
        • O'Donnell C.J.
        • Larson M.G.
        • Feng D.
        • Sutherland P.A.
        • Lindpaintner K.
        • Myers R.H.
        • et al.
        Genetic and environmental contributions to platelet aggregation: the Framingham Heart Study.
        Circulation. 2001; 103: 3051-3056
        • Hetherington S.L.
        • Singh R.K.
        • Lodwick D.
        • Thompson J.R.
        • Goodall A.H.
        • Samani N.J.
        Dimorphism in the P2Y1 ADP receptor gene is associated with increased platelet activation response to ADP.
        Arterioscler Thromb Vasc Biol. 2005; 25: 252-257
        • Jones C.I.
        • Bray S.
        • Garner S.F.
        • Stephens J.
        • de Bono B.
        • Angenent W.G.
        • et al.
        A functional genomics approach reveals novel quantitative trait loci associated with platelet signaling pathways.
        Blood. 2009; 114: 1405-1416
        • Stasko J.
        • Bartosova L.
        • Mytnik M.
        • Kubisz P.
        Are the platelets activated in sticky platelet syndrome?.
        Thromb Res. 2011; 128: 96-97